Test effectué le 01/11/2009 à 22:16:02
Mots clés
pcem1 carab1
Résultat de votre test
| Moteur de recherche |
Url |
Mots clés |
Résultat |
| google.fr (Web) | www.carab1.net | pcem1 carab1 | 1 |
Sites
www.carab1.net
Titre : carab1.net - Le portail web des premières années de médecineDescription : carab1.net: le meilleur d'internet pour reussir la PCEM1 / L1 sante. Tous les sites et cours incontournables du web, rejoignez la communauté des carabins 2.0 !
Résultats pour "pcem1 carab1" / google.fr (Web)
- 1 / carab1.net - A propos : http://www.carab1.net/index.php/a-propos
- 2 / carab1.net - Le portail web des premières années de médecine : http://www.carab1.net/
- 3 / Forum NANTES - page 10 : http://forums.remede.org/nantes/72_10.html
- 4 / Et plus tard... : http://forums.remede.org/questions_generales_-medecine-/sujet_24549.html
- 5 / Petite question - E-Carabin - Le forum officiel des étudiants en ... : http://www.e-carabin.net/showthread.php?p=1216018
- 6 / ada.dat *********** >aidB tgctggataagaatgttttagcaatctcttt >ada ... : http://arep.med.harvard.edu/ecoli_matrices/dat/all_matrices.dat
- 7 / Le Carabin Virtuel : http://membres.lycos.fr/v20100/carab1.htm
- 8 / Algorithm of Regulatory Signal Recognition in DNA Sequences : http://www.springerlink.com/index/UN4V052738H0634U.pdf
- 9 / HistCite - node 8034: Reconstructing species phylogeny of the ... : http://www.garfield.library.upenn.edu/histcomp/avise-jc_w-citing/node/8033.html
- 10 / Biosynthesis and Metabolism of Arginine in Bacteria : http://mmbr.asm.org/cgi/reprint/50/3/314.pdf
Recherches similaires